For the Professional Diagnostician

What Is It? | Facts in Depth | For the Professional Diagnostician

Hop Diseases | Downy Mildew

Hops Downy Mildew

Symptoms

Typical symptoms of the disease are angular, chlorotic lesions visible on the upper side of the leaf.  Purple–grey or black growth, which includes the sporangia of the pathogen, may appear on the bottom of the leaf or spike.

One of the most characteristic downy mildew symptoms is the presence of systemically infected shoots, called “spikes”. Primary spikes emerge from the crown, while secondary spikes are diseased shoots that appear from the growing point of an infected plant. Spikes are stunted, with short internodes, and appear chlorotic with yellow green, downward curling leaves.

The plant tissue below the infection point looks normal in appearance with a secondary spike. Infected cones may exhibit dark brown discoloration.  Infected crowns of hops may show reddish-brown to black flecks and streaks due to downy mildew infection.

HopsDM2_50Quality HopsDM5_50Quality HopsDM6_50Quality

Signs

Spore-bearing sporangia are present on the undersides of the leaves as a black to purple mold.  Under a microscope, these sporangia are hyaline and approximately 32.5-39.5 µ x 19.7- 22.5 µ in water.  In dry conditions, these sporangia are smaller, approximately 24.8-32.5 µ x 16.5-20.8 µ, and darker in color (Sonoda and Ogawa, 1970).

Often Confused With

  • Frost Damage – Causes similar symptoms to those caused by hops downy mildew. The foliage becomes very chlorotic and stunted and necrosis forms in new leaves and shoots of the plant, which resembles the “spikes” produced from downy mildew infection.
  • Two-spotted spider mite damage

Isolation Media

Pseudoperonospora humuli is an obligate biotrophic pathogen, meaning that it can only survive on living plant cells and cannot be isolated or cultured on artificial growth media.

Rapid Diagnostic Tests

  • Primers HDM04 (5’AG CCACACAACACATAGT3’) and HDM07 (5’AGA ATTGACTGCGAGTCC3’) were designed from the consensus sequence and used with primers ITS1 and ITS4, respectively, to direct amplification of DNA fragments specific to humuli (Gent et. al., 2009)
  • The specific rDNA of Pseudoperonospora humuli sequences were amplified using the primers P1 (CTGAGGGGACGAAAGGCTCTG) derived from ITS1 and P2 (CTGGTCACATGGACAGCCTTCA) derived from ITS2 (Patzak, 2005)